View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6217_low_11 (Length: 241)
Name: NF6217_low_11
Description: NF6217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6217_low_11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 21 - 241
Target Start/End: Original strand, 25262952 - 25263172
Alignment:
| Q |
21 |
gattctgtaatagtttggactttggaggaacttaaaatgctgataactctatttgtcccataatgtctaatagtttaagcttttggatggtaataataat |
120 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25262952 |
gattctgtaatagtttgaactttggaggaacttaacatgctgataactctatttgtcccataatgtctaatagtttaagcttttggatggtaataaaaat |
25263051 |
T |
|
| Q |
121 |
taacatggggctccaagttcaaccattatatacagaatgtctgtttccaatacttgcctaaagtcaattagagagctcgtagggattcaatataaaaaga |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25263052 |
taacatggggctccaagttcaaccattatatacagaatgtctgtttccaatacttgcataaagtcaattagagagctcgtagggattgaatataaaaaga |
25263151 |
T |
|
| Q |
221 |
ttgatataaaaataaacagat |
241 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
25263152 |
ttgatataaaaatcaacagat |
25263172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University