View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6217_low_12 (Length: 237)
Name: NF6217_low_12
Description: NF6217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6217_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 5 - 219
Target Start/End: Complemental strand, 48635501 - 48635277
Alignment:
| Q |
5 |
ctatacactacattcaattccattccgtgcaactttcaccttaatatatata----------gattagtccatctcctctacatactcgnnnnnnnnnnn |
94 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
48635501 |
ctatacactacattccattccattccgtgcaactttcaccttaatatatatatatatatatagattagtccatctcctctacatacttgttttttctttt |
48635402 |
T |
 |
| Q |
95 |
nnngggtgataattggcctttgaagaacagtactagttttcaatattgattatggatgatgctaaggtccttagaaagagaaagggatttggttttagca |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48635401 |
tttgggtgataattggcctttgaagaacagtactagttttcaatattgattatggatgatgctaaggtccttagaaagagaaagggatttggttttagca |
48635302 |
T |
 |
| Q |
195 |
acaaatgcacttctttggttaagga |
219 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48635301 |
acaaatgcacttctttggttaagga |
48635277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University