View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6218_high_5 (Length: 336)
Name: NF6218_high_5
Description: NF6218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6218_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 61 - 319
Target Start/End: Complemental strand, 19230833 - 19230573
Alignment:
| Q |
61 |
agggtttatcttttctcatgccatttttatgtatctcatatttatatccttaatgaacttgattgttgttaattattctaaaatcaaacaaatcaaannn |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
19230833 |
agggtttatcttttctcatgccatttttatgtatctcatatttatatccttaatgaacttggttgttgttaattattctaaaaacaaacaaatcaatttt |
19230734 |
T |
 |
| Q |
161 |
nnnnnnnnnn--aaaacccctttgatgtggtgttaggggttttaggatttgatttgataactcgaaaattttgtctttttctgctcatgattttgatcta |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19230733 |
ttttttttttttaaaacccctttgatgtggtgttaggggttttaggatttgatttgataactcgaaaattttgtctttttctgctcatgattttgatcta |
19230634 |
T |
 |
| Q |
259 |
gtttgaggttttcatccaaagacacaaactttagttgttttgttgattagggtaaattatg |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19230633 |
gtttgaggttttcatccaaagacacaaactttagttgttttgttgattagggtaaattatg |
19230573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 171 - 319
Target Start/End: Complemental strand, 19239905 - 19239767
Alignment:
| Q |
171 |
aaaacccctttgatgtggtgttaggggttttaggatttgatttgataactcgaaaattttgtctttttctgctcatgattttgatctagtttgaggtttt |
270 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
19239905 |
aaaacccatttgatgtggtgttaggggttttaggatttgatttgataactcgaaaattttgtctttt-------atgattttgatctactttgaggtttt |
19239813 |
T |
 |
| Q |
271 |
catccaaagacacaaactttagttgttttgttgattagggtaaattatg |
319 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| || ||| ||||||| |
|
|
| T |
19239812 |
catccaaagatacaaactt---ttgttttgttgactacggttaattatg |
19239767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 105 - 156
Target Start/End: Complemental strand, 19239969 - 19239918
Alignment:
| Q |
105 |
tatccttaatgaacttgattgttgttaattattctaaaatcaaacaaatcaa |
156 |
Q |
| |
|
|||||||| |||| ||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19239969 |
tatccttagtgaatttggttgttgttagttattctaaaaacaaacaaatcaa |
19239918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 61 - 99
Target Start/End: Complemental strand, 19240054 - 19240016
Alignment:
| Q |
61 |
agggtttatcttttctcatgccatttttatgtatctcat |
99 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
19240054 |
agggtttatcttttctcatgccattttcacgtatctcat |
19240016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University