View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6218_high_9 (Length: 240)
Name: NF6218_high_9
Description: NF6218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6218_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 105 - 221
Target Start/End: Complemental strand, 53424949 - 53424833
Alignment:
| Q |
105 |
catcgaccaaatcttagaagattctcgaatcgaacttcgtttatggaagctaatatgcagaggaagaagatggataagaaacataagagcatgaaacgtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53424949 |
catcgaccaaatcttagaagattctcgaatcgaacttcgtttatggaagctaatatgcagaggaagaagatggataagaaacataagagcatgaaacgtt |
53424850 |
T |
|
| Q |
205 |
ttctgtttggttttggg |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
53424849 |
ttctgtttggttttggg |
53424833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 53425053 - 53425017
Alignment:
| Q |
1 |
cgggaagtgtgagaactccgatgaggattcgaatctc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53425053 |
cgggaagtgtgagaactccgatgaggattcgaatctc |
53425017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University