View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6218_low_15 (Length: 221)

Name: NF6218_low_15
Description: NF6218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6218_low_15
NF6218_low_15
[»] chr8 (1 HSPs)
chr8 (59-204)||(32747152-32747291)


Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 59 - 204
Target Start/End: Original strand, 32747152 - 32747291
Alignment:
59 gtgaatcactaatctagttcttgaaattttctagggtgggtttttgctactccagaggagctggtagtggtgagtatggtggctatttttcacggtatgg 158  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||    
32747152 gtgaatcactaatctagttcttgaaattttctagggtgggtttttgctactccagaggagctggt------gagtatggtggctatttttcacggtatgg 32747245  T
159 ggacagtggtcagtctaagttaggaatgaccttagtttggcatatt 204  Q
    |||||||||||||||||||||||||||| |||||||||||||||||    
32747246 ggacagtggtcagtctaagttaggaatggccttagtttggcatatt 32747291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University