View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6218_low_6 (Length: 371)
Name: NF6218_low_6
Description: NF6218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6218_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 67 - 195
Target Start/End: Original strand, 13910956 - 13911084
Alignment:
| Q |
67 |
caacacgcaccgtcgttcctggattcgaccgattcttcaacgcaatcaccggtttaaacggttccggtaaatcgaacattctcgattcgatttgcttcgt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13910956 |
caacacgcaccgtcgttcctggattcgaccgattcttcaacgcaatcaccggtttaaatggttccggtaaatcgaatattctcgattcgatttgcttcgt |
13911055 |
T |
|
| Q |
167 |
tcttggaatcaccaatttgacacaggttc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13911056 |
tcttggaatcaccaatttgacacaggttc |
13911084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University