View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6219_low_5 (Length: 243)
Name: NF6219_low_5
Description: NF6219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6219_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 23 - 222
Target Start/End: Complemental strand, 33350778 - 33350580
Alignment:
| Q |
23 |
atgtactcatgtcaaattnnnnnnntaatttacaaaaattgagccattataatgcttattttagactatttaagaagagtgtgtatgatagtggctatac |
122 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33350778 |
atgtactcatgtcaaattaaataaataatttacaaaaattgagccattataatgcttattttagactatttaagaagagtgtgtatgatagtggctatac |
33350679 |
T |
 |
| Q |
123 |
tctgaaattgttcagttgattcaatcacatggatagctgatgagactcatatgagagaccatagtttctttagaagtctgaatttctttatcataatttt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33350678 |
tctgaaattgttcagttgattcaatcacatggatagctg-tgagactcatatgagagaccatagtttctttagaagtctgaatttctttatcataatttt |
33350580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University