View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6220_low_2 (Length: 329)
Name: NF6220_low_2
Description: NF6220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6220_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 32210208 - 32210418
Alignment:
| Q |
12 |
agtagcataggcagcacagtcaggttttgggaaagatttagacaaagacaagacagcagaagctgctggtgatcttctagatgcagttggtcagtatgct |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32210208 |
agtagcagaggcagcacagtcaggttttgggaaagatttagacaaagacaagacagcagaagctgctggtgatcttctagatgcagttggtcagtatgct |
32210307 |
T |
|
| Q |
112 |
aaattggatgatcagaaaggtgttggatcatatgttgataaagctgctgattatctgcataagtatgagaacactactactgctactccaccagcttcta |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32210308 |
aaattggatgatcagaaaggtgtaggatcatatgttgataaagctgctgattatctgcataagtatgagaacactactactgctactccaccagcttcta |
32210407 |
T |
|
| Q |
212 |
aacctgcagat |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
32210408 |
aacctgcagat |
32210418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 73 - 171
Target Start/End: Original strand, 32190894 - 32190992
Alignment:
| Q |
73 |
gctgctggtgatcttctagatgcagttggtcagtatgctaaattggatgatcagaaaggtgttggatcatatgttgataaagctgctgattatctgcat |
171 |
Q |
| |
|
||||| || |||||||| ||||| |||||||||||||||||||||||||||||||| || | ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
32190894 |
gctgcaggagatcttcttgatgcggttggtcagtatgctaaattggatgatcagaaggggttaggacagtatgttgataaggctgctgattatctgcat |
32190992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University