View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6220_low_6 (Length: 219)
Name: NF6220_low_6
Description: NF6220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6220_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 8 - 195
Target Start/End: Original strand, 11987492 - 11987679
Alignment:
| Q |
8 |
agcagcacagacaatagcttcaaggagaatattcccggcggcaatgaaagcgaggaagtcaccgagttcgattcttaggaatgaaaacgaaccaccggca |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11987492 |
agcagcaccgacaatagcttcaaggagaatattcccggcagcaatgaaagcgaggaagtcaccgagttcgattcttaggaatcaaaacgaaccaccggca |
11987591 |
T |
 |
| Q |
108 |
acgggaacttcaactgcgaattcagcatagatgaaagctgaaagaagagctgagaatcctgaagcagcgtaggagaggataatggaag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11987592 |
acgggaacttcaactgcgaattcagcatagatgaaagctgaaagaagagctgagaatcctgaagcggcgtaggagaggataatggaag |
11987679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 9 - 195
Target Start/End: Original strand, 21597729 - 21597915
Alignment:
| Q |
9 |
gcagcacagacaatagcttcaaggagaatattcccggcggcaatgaaagcgaggaagtcaccgagttcgattcttaggaatgaaaacgaaccaccggcaa |
108 |
Q |
| |
|
||||||| ||| | ||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||||| |||||||||||||| ||||| |||| |
|
|
| T |
21597729 |
gcagcaccgacgagagcttcaaggagaatattcccagcggcaatgaaagcgagaaaatcaccaagttcaattctaaggaatgaaaacgagccaccagcaa |
21597828 |
T |
 |
| Q |
109 |
cgggaacttcaactgcgaattcagcatagatgaaagctgaaagaagagctgagaatcctgaagcagcgtaggagaggataatggaag |
195 |
Q |
| |
|
| ||||||||||| ||||||||||| ||||| ||||||||||||||||| ||||| ||||| || ||||| |||||||||||||||| |
|
|
| T |
21597829 |
caggaacttcaacggcgaattcagcgtagattaaagctgaaagaagagcagagaaacctgacgcggcgtaagagaggataatggaag |
21597915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University