View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6221_high_20 (Length: 310)
Name: NF6221_high_20
Description: NF6221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6221_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 11 - 290
Target Start/End: Complemental strand, 34570476 - 34570197
Alignment:
| Q |
11 |
gagcacagacaatataaatgcttcaaagcggggaattcttagaatgtcattatgaactttataaactaaatgaccatgctttctaatgcagggtcggcta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570476 |
gagcacagacaatataaatgcttcaaagcggggaattcttagaatgtcattatgaactttataaactaaatgaccatgctttctaatgcagggtcggcta |
34570377 |
T |
|
| Q |
111 |
tttctttctgcaagggttctgggattttatgcaaatttgtttgggcataaaacaaaatttttcttcctttgggaagatattgataacattcaagtgcttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570376 |
tttctttctgcaagggttctgggattttatgcaaatttgtttggacataaaacaaaatttttcttcctttgggaagatattgataacattcaagtgcttc |
34570277 |
T |
|
| Q |
211 |
ctccatcattagcatcattaggaagtcctacattggccgtaattcttcgaagaggacgaggtatcgatgcaaggcacggt |
290 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570276 |
ctccatcattagcatcattaggaagccctacattggccgtaattcttcgaagaggacgaggtatcgatgcaaggcacggt |
34570197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 97 - 193
Target Start/End: Original strand, 56175998 - 56176094
Alignment:
| Q |
97 |
tgcagggtcggctatttctttctgcaagggttctgggattttatgcaaatttgtttgggcataaaacaaaatttttcttcctttgggaagatattga |
193 |
Q |
| |
|
|||||||||| |||||| |||| ||||| | || |||||| |||||||||||||||| || || |||||||| || || |||||||| || ||||| |
|
|
| T |
56175998 |
tgcagggtcgtctatttgtttcagcaagaatacttggatttcatgcaaatttgtttggacacaagacaaaattctttttgctttgggaggacattga |
56176094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University