View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6221_high_29 (Length: 280)
Name: NF6221_high_29
Description: NF6221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6221_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 82 - 122
Target Start/End: Complemental strand, 11122559 - 11122519
Alignment:
| Q |
82 |
caagttgaacgcatgttcaaagaaatttcacaccaaaaaca |
122 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11122559 |
caagttgaagtcatgttcaaagaaatttcacaccaaaaaca |
11122519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University