View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6221_high_34 (Length: 239)
Name: NF6221_high_34
Description: NF6221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6221_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 26 - 230
Target Start/End: Complemental strand, 5413197 - 5412993
Alignment:
| Q |
26 |
tgtgtgttaaccatctcgttaagataattaatcgcatacgaattgtttaaccttctatattgttgtcgaatttgatgctaaatttgcgtgtcaaaagtta |
125 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5413197 |
tgtgtgttaaccatctcgtttagataattaatcgcatacgaattgtttaaccttctatattgttgtcgaatttgatgctaaatttgcgtgtcaaaagtta |
5413098 |
T |
 |
| Q |
126 |
tgcagatggctcctaatggcctagtctaaagttagaataacannnnnnnnnnnnattaaaagaaaatcaagattttgtgagtgaccattatgcttctttt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5413097 |
tgcagatggctcctaatggcctagtctaaagttagaataacattttttttttttattaaaagaaaatcaagattttgcgagtgaccattatgcttctttt |
5412998 |
T |
 |
| Q |
226 |
catct |
230 |
Q |
| |
|
||||| |
|
|
| T |
5412997 |
catct |
5412993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University