View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6221_high_39 (Length: 226)

Name: NF6221_high_39
Description: NF6221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6221_high_39
NF6221_high_39
[»] chr1 (1 HSPs)
chr1 (10-210)||(42700148-42700348)


Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 10 - 210
Target Start/End: Original strand, 42700148 - 42700348
Alignment:
10 catcacttttcttgttcatcaacgacacttcttgaatttatctttaaactatatccatgaggtgattatgaattgtggatgtataccttaaaattgtgtt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42700148 catcacttttcttgttcatcaacgacacttcttgaatttatctttaaactatatccatgaggtgattatgaattgtggatgtataccttaaaattgtgtt 42700247  T
110 gttaggcagattatatgaagcttatatctttcttttactctttttaccgggcgatcagtgaccctctcatattttatcactcgtctaatttaatattgat 209  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||    
42700248 gttaggcaggttatatgaagcttatatctttcttttactctttttaccgggcgatcagtgacactctcatattttatcactcgtctaatttattcttgat 42700347  T
210 t 210  Q
    |    
42700348 t 42700348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University