View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6221_low_24 (Length: 307)

Name: NF6221_low_24
Description: NF6221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6221_low_24
NF6221_low_24
[»] chr8 (1 HSPs)
chr8 (7-64)||(3192108-3192165)
[»] chr6 (1 HSPs)
chr6 (7-64)||(30835336-30835393)


Alignment Details
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 7 - 64
Target Start/End: Complemental strand, 3192165 - 3192108
Alignment:
7 gcagactagccaacaaatggattttgaatgattatagtgcccttttgatgcttgcttg 64  Q
    |||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||    
3192165 gcagactagccaacaaatggattttgaatgattacagggccctgttgatgcttgcttg 3192108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 7 - 64
Target Start/End: Complemental strand, 30835393 - 30835336
Alignment:
7 gcagactagccaacaaatggattttgaatgattatagtgcccttttgatgcttgcttg 64  Q
    |||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||    
30835393 gcagactagccaacaaatggattttgaatgattacagggccctgttgatgcttgcttg 30835336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University