View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6221_low_24 (Length: 307)
Name: NF6221_low_24
Description: NF6221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6221_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 7 - 64
Target Start/End: Complemental strand, 3192165 - 3192108
Alignment:
| Q |
7 |
gcagactagccaacaaatggattttgaatgattatagtgcccttttgatgcttgcttg |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
3192165 |
gcagactagccaacaaatggattttgaatgattacagggccctgttgatgcttgcttg |
3192108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 7 - 64
Target Start/End: Complemental strand, 30835393 - 30835336
Alignment:
| Q |
7 |
gcagactagccaacaaatggattttgaatgattatagtgcccttttgatgcttgcttg |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
30835393 |
gcagactagccaacaaatggattttgaatgattacagggccctgttgatgcttgcttg |
30835336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University