View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6221_low_31 (Length: 280)

Name: NF6221_low_31
Description: NF6221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6221_low_31
NF6221_low_31
[»] chr4 (1 HSPs)
chr4 (82-122)||(11122519-11122559)


Alignment Details
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 82 - 122
Target Start/End: Complemental strand, 11122559 - 11122519
Alignment:
82 caagttgaacgcatgttcaaagaaatttcacaccaaaaaca 122  Q
    |||||||||  ||||||||||||||||||||||||||||||    
11122559 caagttgaagtcatgttcaaagaaatttcacaccaaaaaca 11122519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University