View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6221_low_41 (Length: 226)
Name: NF6221_low_41
Description: NF6221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6221_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 10 - 210
Target Start/End: Original strand, 42700148 - 42700348
Alignment:
| Q |
10 |
catcacttttcttgttcatcaacgacacttcttgaatttatctttaaactatatccatgaggtgattatgaattgtggatgtataccttaaaattgtgtt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42700148 |
catcacttttcttgttcatcaacgacacttcttgaatttatctttaaactatatccatgaggtgattatgaattgtggatgtataccttaaaattgtgtt |
42700247 |
T |
|
| Q |
110 |
gttaggcagattatatgaagcttatatctttcttttactctttttaccgggcgatcagtgaccctctcatattttatcactcgtctaatttaatattgat |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
42700248 |
gttaggcaggttatatgaagcttatatctttcttttactctttttaccgggcgatcagtgacactctcatattttatcactcgtctaatttattcttgat |
42700347 |
T |
|
| Q |
210 |
t |
210 |
Q |
| |
|
| |
|
|
| T |
42700348 |
t |
42700348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University