View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6221_low_45 (Length: 207)
Name: NF6221_low_45
Description: NF6221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6221_low_45 |
 |  |
|
| [»] scaffold0565 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0565 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 4468 - 4648
Alignment:
| Q |
1 |
tgttctcatctccaaaagaattttccaattgggacactgtcctttggtaattttgcacttgccctctaaaactaattcgttgtccctac-aaaatagtga |
99 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4468 |
tgttctcatctccaaaataatttaccaattgggacactgtcctttggtaattttgcacttgccctctaaaactaattcgttgtccctacaaaaatagtga |
4567 |
T |
 |
| Q |
100 |
taaattatggaaagtaattaaggatgtggtggctatccaaatgaagtaaaaagataatcatatgtgacattattaattagaagc |
183 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4568 |
taaattatggaaaataattaaggat---gtggctatccaaatgaagtaaaaaaataatcatatgtgacattattaattagaagc |
4648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 5 - 92
Target Start/End: Complemental strand, 7614736 - 7614649
Alignment:
| Q |
5 |
ctcatctccaaaagaattttccaattgggacactgtcctttggtaattttgcacttgccctctaaaactaattcgttgtccctacaaa |
92 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||||| ||||||| ||||| |||||||| ||||||||||| || | |||||||||| |
|
|
| T |
7614736 |
ctcatctccaagcaaatttaccacttgggacactgtcttttggtagttttgtacttgcccactaaaactaatacgatctccctacaaa |
7614649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 29 - 92
Target Start/End: Complemental strand, 8491840 - 8491777
Alignment:
| Q |
29 |
ttgggacactgtcctttggtaattttgcacttgccctctaaaactaattcgttgtccctacaaa |
92 |
Q |
| |
|
||||||||||||| ||||||| ||||| ||||| || ||||||||||| || | |||||||||| |
|
|
| T |
8491840 |
ttgggacactgtcttttggtagttttgtacttgaccactaaaactaatacgatctccctacaaa |
8491777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University