View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6221_low_47 (Length: 201)
Name: NF6221_low_47
Description: NF6221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6221_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 19 - 140
Target Start/End: Original strand, 7128230 - 7128353
Alignment:
| Q |
19 |
ttggtgttgtgcttgagcaagaatgggatgttgggtgaattttgatgttgtgattgatcaaggatgggtgttggttgaatttaagtgctagatatgtc-- |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7128230 |
ttggtgttgtgcttgagcaagaatgg-atgttgggtgaattttgatgttgtgattgatcaaggatgggtgttggttgaatttaagtgctagatatgtcta |
7128328 |
T |
|
| Q |
117 |
-tatatcatgcttgaatttctaaat |
140 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7128329 |
ttatatcatgcttgaatttctaaat |
7128353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 7124738 - 7124795
Alignment:
| Q |
123 |
atgcttgaatttctaaatgtgatgtctactgttggttttcttttgatcacattgatga |
180 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
7124738 |
atgcttgtatttcaaaatttgatgtctactgttggttttcttgtgatcccattgatga |
7124795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 185
Target Start/End: Original strand, 7128355 - 7128383
Alignment:
| Q |
157 |
gttttcttttgatcacattgatgatcctg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7128355 |
gttttcttttgatcacattgatgatcctg |
7128383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 185
Target Start/End: Complemental strand, 739063 - 738985
Alignment:
| Q |
114 |
gtctatatcatgcttgaatttctaaatgtgatgtcta-------ctgttggttttcttttgatcacattgatgatcctg |
185 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| ||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
739063 |
gtctatatcatgcttgtatttgtaaatgtgatgactactgttgcctgttggttttcttttgatctcattgatgaccctg |
738985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University