View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6224_high_2 (Length: 324)
Name: NF6224_high_2
Description: NF6224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6224_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 143 - 310
Target Start/End: Complemental strand, 5256893 - 5256725
Alignment:
| Q |
143 |
tatcatcctccatagaatgcataagtacc-acttcatccaccatttcagtattcctctcttcatctgtttgttcagtacataagttgagggggaataaat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5256893 |
tatcatcctccatagaatgcataagtacccacttcatccaccatttcagtattcctctcttcatctgtttgttcagtacataagttgagggggaataaat |
5256794 |
T |
 |
| Q |
242 |
aaaatataaccacacaatcacggctaaaggttaatagtattcaaccaacattggattgttccaattgat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||| |
|
|
| T |
5256793 |
aaaatataaccacacaatcacggctaaaggttaagcgtattcaaccaacaatggattggtccaattgat |
5256725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University