View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6224_high_3 (Length: 287)
Name: NF6224_high_3
Description: NF6224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6224_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 22 - 276
Target Start/End: Original strand, 38484374 - 38484632
Alignment:
| Q |
22 |
gaggtgttcatcatgatcatgatgaagaggaaggataatactagaagggtttagagactagagtgatttcttttgaaataaaggaatgattaggtttgtg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38484374 |
gaggtgttcatcatgatcatgatgaagaggaaggataatactaaaagggtttagagactagagtggtttcttttgaaataaaggaatgattaggtttgtg |
38484473 |
T |
 |
| Q |
122 |
aaaaaccaaagtaggaagggaatgagatgcatattttgcggtgagtaatgatttcattttgtctgggaaaatgaagggggagaggatatgatttttggtg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484474 |
aaaaaccaaagtaggaagggaatgagatgcatattttgcggtgagtaatgatttcattttgtctgggaaaatgaagggggagaggatatgatttttggtg |
38484573 |
T |
 |
| Q |
222 |
ggta----tattatgtaatgtagtatcattgcttaatggtcatactcatgatgatgatg |
276 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484574 |
ggtataagtattatgtaatgtagtatcattgcttaatggtcatactcatgatgatgatg |
38484632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University