View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6224_high_4 (Length: 242)

Name: NF6224_high_4
Description: NF6224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6224_high_4
NF6224_high_4
[»] chr3 (1 HSPs)
chr3 (12-242)||(38484665-38484895)


Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 242
Target Start/End: Complemental strand, 38484895 - 38484665
Alignment:
12 atgaatcacattcatgtctaattttatgtacatgcatccaattttgtgagtaactactattacnnnnnnnnaggggatgagtaaaactgtaaaaggattg 111  Q
    ||||||| |||||||||||||||||||||||||||||||||||||  ||||||||||||||||        |||||||||||||||||||||||||||||    
38484895 atgaatctcattcatgtctaattttatgtacatgcatccaattttcagagtaactactattacttttttttaggggatgagtaaaactgtaaaaggattg 38484796  T
112 ggaaagatgaatgtgattgtgaatgcacgtgaacgtagaggggctgaagttgatccatccatataaccctgtggggtatgattatgaatgatgagtgaaa 211  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38484795 ggaaagataaatgtgattgtgaatgcacgtgaacgtagaggggctgaagttgatccatccatataaccctgtggggtatgattatgaatgatgagtgaaa 38484696  T
212 aagtaaagtgaattccaaatggaagcactta 242  Q
    ||||| |||||||||||||||||||||||||    
38484695 aagtatagtgaattccaaatggaagcactta 38484665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University