View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6224_high_4 (Length: 242)
Name: NF6224_high_4
Description: NF6224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6224_high_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 242
Target Start/End: Complemental strand, 38484895 - 38484665
Alignment:
| Q |
12 |
atgaatcacattcatgtctaattttatgtacatgcatccaattttgtgagtaactactattacnnnnnnnnaggggatgagtaaaactgtaaaaggattg |
111 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38484895 |
atgaatctcattcatgtctaattttatgtacatgcatccaattttcagagtaactactattacttttttttaggggatgagtaaaactgtaaaaggattg |
38484796 |
T |
|
| Q |
112 |
ggaaagatgaatgtgattgtgaatgcacgtgaacgtagaggggctgaagttgatccatccatataaccctgtggggtatgattatgaatgatgagtgaaa |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484795 |
ggaaagataaatgtgattgtgaatgcacgtgaacgtagaggggctgaagttgatccatccatataaccctgtggggtatgattatgaatgatgagtgaaa |
38484696 |
T |
|
| Q |
212 |
aagtaaagtgaattccaaatggaagcactta |
242 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |
|
|
| T |
38484695 |
aagtatagtgaattccaaatggaagcactta |
38484665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University