View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6225_high_13 (Length: 250)
Name: NF6225_high_13
Description: NF6225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6225_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3896106 - 3895885
Alignment:
| Q |
1 |
ttgtccacctttttctgatttcaccaagctcatttctttctttctctcccccaccaaaataacaacctgaaaaggctagcatatctggttcaaatctgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3896106 |
ttgtccacctttttctgatttcaccaagctcatttctttctttctctcccccaccaaaataacaacctgaaaaggctagcatatctggttcaaatctgca |
3896007 |
T |
|
| Q |
101 |
ataagctcatatctggttcatgaatgagattgttagtggcaattacaaa-----------gcatcccaaattcttatttctaacattggaatgaaacaag |
189 |
Q |
| |
|
|||| | |||||| |||||||||| | ||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3896006 |
ataa--------aagaatcatga--gagattgttaattgcaattacaaaggatcctatgcgcatcccaaactcttatttctaacattggaatgaaacaag |
3895917 |
T |
|
| Q |
190 |
aaaatgtgttattaacgtattgttgttattga |
221 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| |
|
|
| T |
3895916 |
aaaatgtgttaataatgtattgttgttattga |
3895885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 43364791 - 43364867
Alignment:
| Q |
18 |
atttcaccaagctcatttctttctttctctcccccaccaaaataacaacctgaaaaggctagcatatctggttcaaa |
94 |
Q |
| |
|
||||||||||| || |||||||| || |||||||||||| |||| ||||| || || || |||||||| |||||||| |
|
|
| T |
43364791 |
atttcaccaagttcttttctttccttttctcccccaccataatagcaaccagagaatgcaagcatatccggttcaaa |
43364867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 41600494 - 41600587
Alignment:
| Q |
1 |
ttgtccacctttttctgatttcaccaagctcatttctttctttctctcccccaccaaaataacaacctgaaaaggctagcatatctggttcaaa |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||| || |||||||||||||||||||||||||| || ||||| ||||| ||||| |
|
|
| T |
41600494 |
ttgtccacctttttctgatttcaccaagctcttgtctttctttttcacccccaccaaaataacaacctgaaaatgccagcatgtctggctcaaa |
41600587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University