View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6225_high_21 (Length: 236)
Name: NF6225_high_21
Description: NF6225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6225_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 30782066 - 30781844
Alignment:
| Q |
1 |
aagaaagttctctctttgaacatcgcttattgtaccaatggttgcaagaaaagggacggtttactttgctttgaatcattcctatcatcagcaaagacct |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30782066 |
aagaaaattctctctttgaacatcgcttattgtaccaatggttgcaagagaagggaccgtttactttgctttgaatcattcctatcatcagcaaagacct |
30781967 |
T |
 |
| Q |
101 |
aattccaagtcttcaaggcaggcgaatccaaaaggactaaaaggaataagtttcctataccctagatggcataggaacatttagaggttagagtagagct |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30781966 |
aattcctagtcttcaaggcaggcgaatccaaaaggactaaaaggaataagtttcctataccctagatggcataggaacatttagaggttagagtagagct |
30781867 |
T |
 |
| Q |
201 |
cacttctccactcggttcttaat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30781866 |
cacttctccactcggttcttaat |
30781844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University