View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6225_high_22 (Length: 228)
Name: NF6225_high_22
Description: NF6225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6225_high_22 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 15808487 - 15808698
Alignment:
| Q |
1 |
cgctttatgcctgaatgtctttgctatattttccatcatgtaagttatccgtaactgtaattcaaactttattaaagtcatactattcatcgtattttcc |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||| ||||| ||||| | |||||||||||||||||||| |
|
|
| T |
15808487 |
cgctttatgcctaaatgtctttgctatattttccatcatgtaagtagtccataactttaattga----------------tactattcatcgtattttcc |
15808570 |
T |
 |
| Q |
101 |
tatgagcctatcatgataactcttannnnnnncttccttccaaagatgtgcaatgatgtctttgggattttatatagcaatacctatcaagtgagtgggg |
200 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15808571 |
tatgagactatcatgataactcttttttttttcttccttccaaagatgtgcaatgatgtctttgggattttatatagcaatacctatcaagtgagtgggg |
15808670 |
T |
 |
| Q |
201 |
atgcatatcagatagtaacgcgtgatga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
15808671 |
atgcatatcagatagtaacgcgtgatga |
15808698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University