View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6225_high_7 (Length: 345)
Name: NF6225_high_7
Description: NF6225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6225_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 73 - 335
Target Start/End: Original strand, 28266343 - 28266604
Alignment:
| Q |
73 |
gagggagtactatttaaaagtgaataattatctctttacaaggtaaaagaatagagttgggctccacaannnnnnnnccttccatctctataagagattc |
172 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28266343 |
gagggagtaatatttaaaagtgaataattatctctttacaaggtaaaagaatagagttgggctccacaaatttttt-ccttccatctctataagagattc |
28266441 |
T |
 |
| Q |
173 |
aaacaatgaaaagtgtctttttcaatcaagtttatttcccattttttcttactttctttccatcaccataatggtcaaaaatagttacttgatcatgtta |
272 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28266442 |
aaacaatgaaaagtgtctttttcaattaagtttatttcccattttttcttactttctttccatcaccatgatggtcaaaaatagttacttgatcatgtta |
28266541 |
T |
 |
| Q |
273 |
gatggaccctttcaacatagtatggaactggattggtcctttttgaatccatacttacctttg |
335 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28266542 |
gatggaccctttcaacatagtatggaagtggattggtcctttttgaatccatacttacctttg |
28266604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University