View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6225_low_15 (Length: 250)
Name: NF6225_low_15
Description: NF6225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6225_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 30782472 - 30782715
Alignment:
| Q |
1 |
tatttaagaaacacaaaattacacacattaatgtatctaagtcatccattgagatcgattcatattacac-ttccattaaataatccaaaagtttatgta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30782472 |
tatttaagaaacacaaaattacacacattaatgtatctaagtcatccattgagatcgattcatattacaccttccattaaataatccaaaagtttatgta |
30782571 |
T |
 |
| Q |
100 |
tctaaatcttcctttccaattggcaatatggtttgcaacactttcaatggtgtttacttatatgtcagccgtttacgcgatcactaggaatctggataac |
199 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30782572 |
tctaaatcttcctttccaattggcgatatggtttgcaacactttcaatggtgtttacttatatgtcagccgtttacgcgatcactaggaatctgtataac |
30782671 |
T |
 |
| Q |
200 |
tgatacaatggatgggtcatgttttctgcgtttgctcctatgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30782672 |
tgatacaatggatgggtcatgttttctgcgtttgctcctttgct |
30782715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University