View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6225_low_18 (Length: 239)
Name: NF6225_low_18
Description: NF6225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6225_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 4 - 223
Target Start/End: Complemental strand, 28266252 - 28266034
Alignment:
| Q |
4 |
aacgaaacaaatttaactgactgtcgttaataaaaaattgttcaatacaagtaggaggaattttaaaaacatatagtgactaacccaaaaatatacctcc |
103 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| || |
|
|
| T |
28266252 |
aacgaaacaaatttaactga-tgtcattaataaaaaattgttcaatacaagtaggaggaattttaaaaacatt--gtgactaacccaaaaacataccgcc |
28266156 |
T |
 |
| Q |
104 |
at--tcattcctaacatcaccatgatggtgcaaaagagtttgtccaccatcctaaatgccccatgttaaaactaattaggagactcacgaaggctgaatt |
201 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28266155 |
atattcattcctaacatcaccatgatggtccaaaagagtttgtccaccatcctaaatgatccatgttaaaactaattaggagactcacgaaggttgaatt |
28266056 |
T |
 |
| Q |
202 |
tctctgccaaattaaagctttg |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28266055 |
tctctgccaaattaaagctttg |
28266034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University