View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6225_low_21 (Length: 237)
Name: NF6225_low_21
Description: NF6225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6225_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 40077633 - 40077421
Alignment:
| Q |
1 |
ttatattaatacttcaatatatttacttatcgtcacattaatacgaatcaacacacttataaataaaatgtgaatctaccatttaaaaatggattgcaca |
100 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40077633 |
ttatattagtacttcaatatatttatttatcgtcacattaatacgaatcaacacgcttataaataaaatgtgaatctaccatttaaaaatggattgcaca |
40077534 |
T |
|
| Q |
101 |
taaattgataaaaccaacataagattaattcgattgaagaataaatgttaaagagtgtcttgaagatagaacattctcaccaccaattaaccttagatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40077533 |
taaattgataaaaccaacataagattaattcgattgaagaataaatgttaaagtgtgtcttgaagatagaacattctcaccaccaattaaccttagatca |
40077434 |
T |
|
| Q |
201 |
atgatatttgaac |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40077433 |
atgatatttgaac |
40077421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University