View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6227_high_30 (Length: 221)
Name: NF6227_high_30
Description: NF6227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6227_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 5485812 - 5485997
Alignment:
| Q |
17 |
agcataggctgatggctaacatggatggcaaatcactccggaatgctaagaaattcattccgataccacctccttcgcctcaatcagcagcaaccggtta |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5485812 |
agcataagctgatggctaacatggatggaaaatcactccggaatgctaagaaattcattccgataccacctccttcgcctcgatcagcagcaaccggtta |
5485911 |
T |
|
| Q |
117 |
tccttgcgagtatgcggcgatgaataatttatcaccgagagggcgaagcagctgtgtctcttctgcaacaagagatctgtgggagc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5485912 |
tccttgcgagtatgcggcgatgaataatttatcaccgagagggcgaagcagctgtgtctcttctgcaacaagagatctgtgggagc |
5485997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University