View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6227_low_23 (Length: 273)
Name: NF6227_low_23
Description: NF6227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6227_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 258
Target Start/End: Original strand, 38095349 - 38095592
Alignment:
| Q |
13 |
tgaagacaagctataagatggacattcgttcacatagaggtggtagagagacgagtccagaccgtgctaaaatatgtaggatgaagcaaaaggtgaaacc |
112 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38095349 |
tgaagacaagcta--agatggacattcgttcacatagaggtggtagagagacgagtccagaccgtgctaaaatatgtaggatgaagcaaaaggtgaaacc |
38095446 |
T |
 |
| Q |
113 |
cattagaaaagttcaggttgtttactatctctcaagaaatggcctattggagcatccacatttcatggaagttaccctttctcctaatcaacctctccgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38095447 |
cattagaaaagttcaggttgtttactatctctcaagaaatggcctattggagcatccacatttcatggaagttaccctttctcctaatcaacctctccgt |
38095546 |
T |
 |
| Q |
213 |
ttaaaaggtactacatttttcttcatatgtagctgctggtttgtga |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38095547 |
ttaaaaggtactacatttttcttcatatgtagctgctgttttgtga |
38095592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University