View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6227_low_25 (Length: 267)
Name: NF6227_low_25
Description: NF6227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6227_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 10 - 256
Target Start/End: Complemental strand, 13889436 - 13889204
Alignment:
| Q |
10 |
ctcgtaatctcacatggagataacatcttaacaaatgataataacctcatggtggagggaacttagattgaagttggcgccctttgaggagagtgttttc |
109 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13889436 |
ctcgtaatctcacattgagataacatcttaacaaatgataataacctcatggaggagggaacttagattgaagttggcgccctttaagg----------- |
13889348 |
T |
 |
| Q |
110 |
ggggacatctttaaagtgttcggattgtgtgacctcgtggaattacctatttaccgtcaatgaataataataatttttgtgataaggttgatgatttgtg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13889347 |
---gacatctttaaagtgttcggattgtgtgatctcgtggagttacctattcaccgtcaatgaataataataatttttgtgataaggttgaagatttgtg |
13889251 |
T |
 |
| Q |
210 |
acaattatttgttgaagttgatttataaaatgtcggttttcattcat |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13889250 |
acaattatttgttgaagttgatttataaaatgtcggttttcattcat |
13889204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University