View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6227_low_27 (Length: 252)
Name: NF6227_low_27
Description: NF6227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6227_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 72 - 230
Target Start/End: Complemental strand, 7887252 - 7887091
Alignment:
| Q |
72 |
tatgtttgaatgttgttttgtaaaaaatattcggatcgaatttcgtaaaattaagttttaatacttata--tatgttgtattctagaggaatcgatagag |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
7887252 |
tatgtttgaatgttgttttgtaaaaaatattcggatcgaatttcgtaaaattaagttttaatacttatatgtatgttgtatttcagaggaatcgatagag |
7887153 |
T |
|
| Q |
170 |
acaagtacaatcaaagagagggaccaagaacaaa-aaatggtccatcaaagaagaaacaatc |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7887152 |
gcaagtacaatcaaagagagggaccaagaacaaagaaatggtccatcaaagaagaaacaatc |
7887091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University