View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6227_low_29 (Length: 246)
Name: NF6227_low_29
Description: NF6227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6227_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 229
Target Start/End: Complemental strand, 9857147 - 9856931
Alignment:
| Q |
13 |
aatattattggtgtcaaaaacggtggaaggcatatttgggcgtgcactgcaatggtattcttcttcatccatggatgaatttgaaaagaaaaaatatcga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
9857147 |
aatattattggtgtcaaaaacggtggaaggcatatttgggcgtgcactgcaatggtattcttcttcatccatggatgaaattgaaaagaaaaaataacga |
9857048 |
T |
|
| Q |
113 |
gtgtggaagaaattggaattttacttgcgagtagaaaagagagtttttgttcctggtacaaaaatacaaaggagagggtttgggaacaaatatcgagagg |
212 |
Q |
| |
|
| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9857047 |
gggttgaataaattggaattttacttgcgagtagaaaagagagtttttgttcctggtacaaaaatacaaaggagagggtttgggaacaaatatcgagagg |
9856948 |
T |
|
| Q |
213 |
tagggttagtcgtattt |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9856947 |
tagggttagtcgtattt |
9856931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University