View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6227_low_30 (Length: 238)

Name: NF6227_low_30
Description: NF6227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6227_low_30
NF6227_low_30
[»] chr1 (1 HSPs)
chr1 (16-222)||(46379801-46380010)


Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 46379801 - 46380010
Alignment:
16 aggaatgtctgatgctctgtcaattgcaactgatcttggttactccgtgtccacaccttcatccaaggtaccgatctttgttttatcctccaactcgcat 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46379801 aggaatgtctgatgctctgtcaattgcaactgatcttggttactccgtgtccacaccttcatccaaggtaccgatctttgttttatcctccaactcgcat 46379900  T
116 ---ttgtttcagaattgaggtttgttaaggtcgtgtcttttcttataggaaggacaacaaaattcttccccagcaaccggggaaaagggtgaggttttga 212  Q
       ||||||||||||||||||||||||||||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||    
46379901 caattgtttcagaattgaggtttgttaaggtcgtctcttttcttataggaaggacgccaaaattcttccccagcaaccggggaaaagggtgaggttttga 46380000  T
213 tcaaagtttt 222  Q
    ||||||||||    
46380001 tcaaagtttt 46380010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University