View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6227_low_30 (Length: 238)
Name: NF6227_low_30
Description: NF6227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6227_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 46379801 - 46380010
Alignment:
| Q |
16 |
aggaatgtctgatgctctgtcaattgcaactgatcttggttactccgtgtccacaccttcatccaaggtaccgatctttgttttatcctccaactcgcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46379801 |
aggaatgtctgatgctctgtcaattgcaactgatcttggttactccgtgtccacaccttcatccaaggtaccgatctttgttttatcctccaactcgcat |
46379900 |
T |
|
| Q |
116 |
---ttgtttcagaattgaggtttgttaaggtcgtgtcttttcttataggaaggacaacaaaattcttccccagcaaccggggaaaagggtgaggttttga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46379901 |
caattgtttcagaattgaggtttgttaaggtcgtctcttttcttataggaaggacgccaaaattcttccccagcaaccggggaaaagggtgaggttttga |
46380000 |
T |
|
| Q |
213 |
tcaaagtttt |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
46380001 |
tcaaagtttt |
46380010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University