View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6229_high_5 (Length: 248)
Name: NF6229_high_5
Description: NF6229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6229_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 49921732 - 49921494
Alignment:
| Q |
1 |
ctccacgttggccattcaactggttaacacaacggtgaatccttggcacctttttgcacccattatcagcaatataaaggacctgatgactcacgattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
49921732 |
ctccacgttggccattcaactggttaacacaatggtgaatccttgacacctttttgcacccattatcagcaatataaaggacctgatggctcgcgattgg |
49921633 |
T |
|
| Q |
101 |
catttacaactgagtcatacgtggcgggaggcgaatgccacgactgatttcatggcgaagatgggcgcgaactataacgaagcttggcaggagtttgtag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49921632 |
catttacaactgagtcatacgtggcgggaggcgaatgccacagctgatttcatggcgaagatgggcgcgaactgtaacgaagcttggcaggagtttgtag |
49921533 |
T |
|
| Q |
201 |
aaccacctgatggtatcttgcctcttctgcatgatgatg |
239 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
49921532 |
aaccacctgatggtatcttgcctctgctgcaggatgatg |
49921494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 8 - 165
Target Start/End: Original strand, 13799732 - 13799889
Alignment:
| Q |
8 |
ttggccattcaactggttaacacaacggtgaatccttggcacctttttgcacccattatcagcaatataaaggacctgatgactcacgattggcatttac |
107 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||| |||||||||| |||||||| ||||||||||||| ||||| || ||| ||| ||| ||| |||| | |
|
|
| T |
13799732 |
ttggcctttcaattggttaacatggaggtgaattcttggcacctctttgcacctgttatcagcaatatcaaggatctaatggctcgcgactggaatttcc |
13799831 |
T |
|
| Q |
108 |
aactgagtcatacgtggcgggaggcgaatgccacgactgatttcatggcgaagatggg |
165 |
Q |
| |
|
||||||||||||||||| ||||||| ||||| || |||||||||||| ||||||||| |
|
|
| T |
13799832 |
aactgagtcatacgtggtgggaggcaaatgctacagctgatttcatggtgaagatggg |
13799889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University