View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6230_low_5 (Length: 250)

Name: NF6230_low_5
Description: NF6230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6230_low_5
NF6230_low_5
[»] chr3 (1 HSPs)
chr3 (1-237)||(48286141-48286377)


Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 48286377 - 48286141
Alignment:
1 ttacagtagttccagggttacaggaatctgcaattccacgactcaaaaagcttttattgaggagaaatgccggtatatttcttgatattgtatagtttgc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48286377 ttacagtagttccagggttacaggaatctgcaattccacgactcaaaaagcttttattgaggagaaatgccggtatatttcttgatattgtatagtttgc 48286278  T
101 ttcaaccattgtgcatgtcatatagtttacaattatttaactgaacaaacagctcttcttgcatgacaccaatacttgtcttgcaaatcatgcatattat 200  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
48286277 ttcaaccattgtgcatgtcatatagtttacaattatttaattgaacaaacagctcttcttacatgacaccaatacttgtcttgcaaatcatgcatattat 48286178  T
201 gatgatcaaaatcacnnnnnnncactgccctcttgtc 237  Q
    |||||||||||||||       |||||||||||||||    
48286177 gatgatcaaaatcactttttttcactgccctcttgtc 48286141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University