View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6231_high_1 (Length: 460)
Name: NF6231_high_1
Description: NF6231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6231_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 317 - 445
Target Start/End: Original strand, 2480735 - 2480863
Alignment:
| Q |
317 |
tatagtgttggagaagtagattacagtaaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaacttgttacgttgta |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2480735 |
tatagtgttggagaagtagattacagtaaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaacttgttacgttgta |
2480834 |
T |
 |
| Q |
417 |
ccatgatcgattggtgcctaatgcctttg |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2480835 |
ccatgatcgattggtgcctaatgcctttg |
2480863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 2480610 - 2480674
Alignment:
| Q |
18 |
atgctctggctgcagcctctgctgtctcaaatgtacctagccatacccttctcttcctgtgtaaa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2480610 |
atgctctggctgcagcctctgctgtctcaaatgtacctagccatacccttctcttcctgtgtaaa |
2480674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 344 - 405
Target Start/End: Complemental strand, 49532403 - 49532342
Alignment:
| Q |
344 |
aaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaactt |
405 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||||||| || || || |||||||||||||| |
|
|
| T |
49532403 |
aaagggtggcgaatttctgacacccaagagccccactggcgctgcctgactcctctgaactt |
49532342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 47101363 - 47101420
Alignment:
| Q |
18 |
atgctctggctgcagcctctgctgtctcaaatgtacctagccatacccttctcttcct |
75 |
Q |
| |
|
||||||| ||||| | |||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
47101363 |
atgctcttgctgcttcttctgctgtttcaaatgttcctagccacacccttctcttcct |
47101420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University