View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6231_low_5 (Length: 233)
Name: NF6231_low_5
Description: NF6231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6231_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 217
Target Start/End: Original strand, 23339306 - 23339504
Alignment:
| Q |
19 |
acaaacacaactggttagcacctgatcagaatttttagacaagctagttgttaaatattgcaggattttacttacaacctgaacctgtactgttaaatca |
118 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23339306 |
acaaacataactggttagcacctgatcagaattcttagacaagctagttgttcaatattgcaggattttacttacaacctgaacatgtactgttaaatca |
23339405 |
T |
 |
| Q |
119 |
taaatggttttaattgaaatgacaaagcaaagcagcattaaaacggtgttcgccgttctgttgcaatgttaacgtccaatcaactcatattactttctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23339406 |
taaatggttttaattgaaatgacaaagcaaagcagcattaaaacggtgttcgccgttctgttgcaatgttaacgtccaatcaactcatattactttctt |
23339504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University