View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6232_high_9 (Length: 243)
Name: NF6232_high_9
Description: NF6232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6232_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 54850337 - 54850117
Alignment:
| Q |
1 |
catgttgcatataacgactccatgtgagataattggttccgttgagcttatgagaagttgtagctgaattaggtccttcgcttggatgtacaaaaaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
54850337 |
catgttgcatataacgactccatgtgagataattggttccgttgagcttatgggaagttgtagctgaattaggtacttcgtttggatgtacaaaaaagat |
54850238 |
T |
 |
| Q |
101 |
ggaatctgattgttgttgatgaacatgaatacgttgttgaaaatcaagaccaagaaatatgagaaattggtgaagataacgaggcaatcaaaactgagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54850237 |
ggaatctgattgttgttgatgaacatgaatacgttgttgaaaatcaagagcaagaaatatgagaaattggtgaagataacgaggcaatcaaaactgagaa |
54850138 |
T |
 |
| Q |
201 |
caccaaagatttctccagaaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
54850137 |
caccaaagatttctccagaaa |
54850117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University