View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6233_low_14 (Length: 270)
Name: NF6233_low_14
Description: NF6233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6233_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 29800276 - 29800518
Alignment:
| Q |
17 |
acttggaacaaataagtttctcttaagttgtcatcatttgcttggaggctaattcaaaatagacttccaacaaagatcaa----------cgtggtatta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29800276 |
acttggaacaaataagtttctcttaagttgtcatcatttgtttggaggctaattcaaaatagacttccaacaaagatcaacgtgtgtcaacgtggtatta |
29800375 |
T |
|
| Q |
107 |
tcaattcagattcttctctttgcttttatggctgtggagtgggcggaaatcaccaccattttttcttcgattgcgcttcttttggtattttttgaaactg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29800376 |
tcaattcagattcttctctttgcttttatggctgtggagtgggcggaaatcaccaccattttttcttcgattgcgcttcttttggtattttttgaaactg |
29800475 |
T |
|
| Q |
207 |
tgttcttaattagttagaaatttcttctaaataatttaatccc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29800476 |
tgttcttaattagttagaaatttcttctaaataatttaatccc |
29800518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University