View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6233_low_21 (Length: 228)
Name: NF6233_low_21
Description: NF6233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6233_low_21 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 6 - 228
Target Start/End: Complemental strand, 32490884 - 32490661
Alignment:
| Q |
6 |
gttatcatatcccgtctctttatcctgcgcaccaaatggccccttaaattagaagagatcaacatcatatgcagtggaaaaataatttattttattaaat |
105 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32490884 |
gttatcatatcctgtctctttatcctgcgcaccaaacggtcccttaagttagaagagatcaacatcatatgcagtggaaaaataatttattttattaaat |
32490785 |
T |
|
| Q |
106 |
atttgt-gaacaagatgtcacatgaggggtagnnnnnnnnnncaagatgttgggagaatcaagaggtttcgaacctagtgataaagaattaatattggtg |
204 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32490784 |
atttgtggaacaagatgtcacatgaggggtagaaaaaaaaaacgagatgttgagagaatcaagaggtttcgaacctagtgataaagaattaatattggtg |
32490685 |
T |
|
| Q |
205 |
gtgaaatgaaactcttgaacgtaa |
228 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32490684 |
gtgaaatgaaactcttgaacgtaa |
32490661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 44
Target Start/End: Original strand, 16290853 - 16290890
Alignment:
| Q |
7 |
ttatcatatcccgtctctttatcctgcgcaccaaatgg |
44 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16290853 |
ttatcatatcctgtctctttatcctgcgcaccaaatgg |
16290890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University