View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6233_low_8 (Length: 365)
Name: NF6233_low_8
Description: NF6233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6233_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 7e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 161 - 326
Target Start/End: Complemental strand, 6836797 - 6836635
Alignment:
| Q |
161 |
tgttgttgttgatgattatgatctttataacaccgacaattctgatcaaagacgtaaccggtgtctgacacaacaacacggacacatgtcatatgtggtt |
260 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
6836797 |
tgttgatgatgatgattatgatctttataacaccgacaattctgatcaaagacgtatccggtgtccgacacaaca---cggacacatgtcatatgtggtt |
6836701 |
T |
 |
| Q |
261 |
acattcaattaattcattttgttcaaatttttgtttgtctgtatttgtgtctctgggtgcttcata |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6836700 |
acattcaattaattcattttgttcaaatttttgtttgtctgtatttgtgtctctgggtgcttcata |
6836635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University