View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6236_high_17 (Length: 243)
Name: NF6236_high_17
Description: NF6236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6236_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 67 - 222
Target Start/End: Complemental strand, 26832197 - 26832042
Alignment:
| Q |
67 |
gagtattatgaatgcttagacttcatttatggctgcattgagttggtttctgcggcaaacgtccgcaatatctaggggttgaggttcgaacctcggactt |
166 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
26832197 |
gagtattatggatgctaagacttcatttatggctgcattgagttggtttctgcggcaaacgtccgcaatatccaggggttgaggttcaaacctcggactt |
26832098 |
T |
 |
| Q |
167 |
ctcacttattcacctttcgatgaatttccaactactaggatgatatagtgcatata |
222 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26832097 |
ctcacttattcacttttagatgaatttccaactactaggatgatatagtgcatata |
26832042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 141 - 193
Target Start/End: Original strand, 10629409 - 10629461
Alignment:
| Q |
141 |
ggggttgaggttcgaacctcggacttctcacttattcacctttcgatgaattt |
193 |
Q |
| |
|
||||||| |||||||||||||||| || || |||||||||||| ||||||||| |
|
|
| T |
10629409 |
ggggttggggttcgaacctcggacatcccatttattcacctttagatgaattt |
10629461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 144 - 181
Target Start/End: Original strand, 3218632 - 3218669
Alignment:
| Q |
144 |
gttgaggttcgaacctcggacttctcacttattcacct |
181 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3218632 |
gttgaggttcgaacctcgaacttctcacttattcacct |
3218669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 182
Target Start/End: Original strand, 24074542 - 24074590
Alignment:
| Q |
134 |
atatctaggggttgaggttcgaacctcggacttctcacttattcacctt |
182 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
24074542 |
atatgtaggggttgaagttcgaacctcggacacctcacttattcacctt |
24074590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 182
Target Start/End: Original strand, 14487597 - 14487645
Alignment:
| Q |
134 |
atatctaggggttgaggttcgaacctcggacttctcacttattcacctt |
182 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
14487597 |
atatgtaggggttggggttcgaacctcggatatcccacttattcacctt |
14487645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 182
Target Start/End: Original strand, 42488745 - 42488793
Alignment:
| Q |
134 |
atatctaggggttgaggttcgaacctcggacttctcacttattcacctt |
182 |
Q |
| |
|
|||| ||||||||| ||||| |||||||||| |||||||||||||||| |
|
|
| T |
42488745 |
atatgtaggggttggggttcaaacctcggacgcctcacttattcacctt |
42488793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 183
Target Start/End: Complemental strand, 31435555 - 31435511
Alignment:
| Q |
139 |
taggggttgaggttcgaacctcggacttctcacttattcaccttt |
183 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||||| |||| |
|
|
| T |
31435555 |
taggggttggggttcgaacctcggacatcccacttattcatcttt |
31435511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University