View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6236_high_21 (Length: 236)
Name: NF6236_high_21
Description: NF6236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6236_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 31788664 - 31788885
Alignment:
| Q |
1 |
ttgatggtgcaagatgaaaagtattgagataacatgcaaaaacaaattggctcaaagagggtgacttgaatactcgtctttattcatgcagccgcttcaa |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31788664 |
ttgatgatgcaagatgaaaagtattgagataacatgcaaaaacaaattggctcaaagagggtgacttgaatactcgtctttattcatgcagccgcttcaa |
31788763 |
T |
 |
| Q |
101 |
ttcggaaacaacaaaatattatcaaatgttcattgatgagaaaggtacgtactgtaattaaagatgatcaaggtatgctcgatgaacaaggtattaggac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31788764 |
ttcggaaacaacaaaatattatcaaatgttcattgatgagaaaggtacgtactgtaattaaagatgatcaaggtatgctcgatgaacaaggtattaggac |
31788863 |
T |
 |
| Q |
201 |
aaggaaaatatttggggctatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31788864 |
aaggaaaatatttggggctatg |
31788885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University