View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6236_low_11 (Length: 329)
Name: NF6236_low_11
Description: NF6236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6236_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 5e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 86 - 319
Target Start/End: Original strand, 33884152 - 33884385
Alignment:
| Q |
86 |
agattatcattgtaactctatctgcagcttctggtttgcctccgaatgttaatcagaagatgtgtttatgaaaatacctgcaaggatgatactccaaagt |
185 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33884152 |
agattatcgttgtaactctatctacagcttctggtttgcctccgaatgttaatcaggaggtgtgtttatgaaaatacctgcaaggatgattatccaaagt |
33884251 |
T |
 |
| Q |
186 |
tgtttcgcagtgaaattctgcctgaattgcaaaaactattgacacttctgttgcagaagtttcaacaagagtggcaagaaaacatgctgaaagatcagga |
285 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||| | || |||||||||||| |
|
|
| T |
33884252 |
tgtttcccagtgaagttctgcctgaattgcaaaagctattgacacttctgttgcagaagtttcagcaacagtggcaagaagatgtgttgaaagatcaggt |
33884351 |
T |
 |
| Q |
286 |
atggtcagctagtttactgcatattttgtctgtg |
319 |
Q |
| |
|
|| ||||||| |||||||||||||||||| |||| |
|
|
| T |
33884352 |
atagtcagcttgtttactgcatattttgtttgtg |
33884385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University