View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6236_low_16 (Length: 266)
Name: NF6236_low_16
Description: NF6236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6236_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 15 - 257
Target Start/End: Complemental strand, 12809765 - 12809523
Alignment:
| Q |
15 |
attttgtgaaactacgtgcatgttttatattacaatggtttgttgaaattgtcgcggctcactggaaattcggctaacccaccatgttaccaaattaaga |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||| |
|
|
| T |
12809765 |
attttgtgaagctacgtgcatgttttattttatgatggtttgttgaaattgtcgcggctcactgaaatttcggctaacccaccatattaccaaattaaga |
12809666 |
T |
|
| Q |
115 |
atcacatagcttatgccaatctcgcctcacatccaaatgtacactagagagacaaaaatgcaaaatttgtttcaattttcatgannnnnnnnccaaccct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
12809665 |
atcacatagcttatgccaatctcgcctcacatccaaatgtacactagagacacaaaaatgcaaaatttgtttcaatttccatgattttttttccaaccct |
12809566 |
T |
|
| Q |
215 |
aaaacgaaaatactttacaagtcgaacatactacgagtattat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
12809565 |
aaaacgaaaatactttacaagtcgaacatactatgagtgttat |
12809523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 210 - 257
Target Start/End: Original strand, 12809341 - 12809388
Alignment:
| Q |
210 |
accctaaaacgaaaatactttacaagtcgaacatactacgagtattat |
257 |
Q |
| |
|
|||| |||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
12809341 |
accccaaaacgaaaataatttacaagtccaacatactatgagtattat |
12809388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University