View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6236_low_25 (Length: 210)
Name: NF6236_low_25
Description: NF6236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6236_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 44622830 - 44623025
Alignment:
| Q |
1 |
gaaaacatgcgctttttgagtgattgtttggaaaccaggggttttgcttcagatcgcagtgaagaaaaactagctgctatgtaatttttcacaggattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44622830 |
gaaaacatgcgctttttgagtgattgtttggaaaccaggggttttgcttcagatcgcagtgaagaaaaactagctgctatgtaatttttcacaggattag |
44622929 |
T |
 |
| Q |
101 |
agttaacagaagcctccacataagctccagagcataaggacnnnnnnngagaggtacagattgcctgtggcgacagcctgcaaaagtaagtataat |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44622930 |
agttaacagaagcctccacatgagctccagagcataaggactttttttgagaggtacagattgcctgtggcgacagcctgcaaaagtaagtataat |
44623025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University