View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6236_low_8 (Length: 368)
Name: NF6236_low_8
Description: NF6236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6236_low_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 17 - 368
Target Start/End: Complemental strand, 50105341 - 50104991
Alignment:
| Q |
17 |
ataagaaactgcatggctagagtgttcttcggaattatccacctgactcacatgttcatcattctcctcactactgctgtgattctcaatttcataacca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50105341 |
ataagaaactgcatggctagagtgttcttcggaattatccgcctgacccacatgttcatcattctcctcactactgctgtgattctcaatttcataacca |
50105242 |
T |
|
| Q |
117 |
gcatcatcactctcggatataggttgcgtatcccttttagaatcatcactgtctgcagaaacatctatgtcggagtcatcttccgatcctctgtttctat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50105241 |
gcatcatcactctcggatataggttgcgtatcccttttagaatcatcactgtctgcagaaacatctatgtcgaagtcatcttccgatcctctgtttctat |
50105142 |
T |
|
| Q |
217 |
cttggtcagcagcaggggactttttccttttgctaagcatcagttc-aaagagtggagattataaaagtagagtcagatacagaatccaaaacacatatc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
50105141 |
cttggtcagcagcaggggactttttccttttgctaagcatcagttcaaaagagtggagattataaaagtagagtcagatacagaatccaaaacac--atc |
50105044 |
T |
|
| Q |
316 |
agagaatggaaattataaatgttggcatgttatacttaagcagcaaatatatt |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50105043 |
agagaatggaaattataaatgttggcatgttatacttaagcagcaaatatatt |
50104991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University