View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6237_high_13 (Length: 292)
Name: NF6237_high_13
Description: NF6237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6237_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 126 - 169
Target Start/End: Complemental strand, 19506154 - 19506111
Alignment:
| Q |
126 |
gcaacttttttattttaaacgatcaaaattacgttccgatctag |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506154 |
gcaacttttttattttaaacgatcaaaattacgttccgatctag |
19506111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 218 - 262
Target Start/End: Complemental strand, 32963741 - 32963697
Alignment:
| Q |
218 |
aaaatgataatgttgttggtttaaaagatgcattacattttctta |
262 |
Q |
| |
|
||||||| ||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
32963741 |
aaaatgaaaatgtggatggttcaaaagatgcattacattttctta |
32963697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University