View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6237_high_17 (Length: 251)
Name: NF6237_high_17
Description: NF6237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6237_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 5686765 - 5687008
Alignment:
| Q |
1 |
atgatagcagaccccaagttatgagagcacttggatatccattagaaacgacagacagaattccagaaattactgaagccaggaatatagagcttggact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5686765 |
atgatagcagaccccaagttatgagagcacttggatatccattagaaatgacagacagaattccagaaattactgaagccaggaatatagagcttggact |
5686864 |
T |
 |
| Q |
101 |
tggattgcaggtagctctactattg-cctctcattctactttcccattttccctttcttgctatttaaagcacaaatctggcctctcttgctagagtagg |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5686865 |
tggattgcaggtagctctactattgccctctcattctactttcccattttccctttcttgctatttaaagcacaaatctggcctctcttgctagagtagg |
5686964 |
T |
 |
| Q |
200 |
gctgctctatctagttataagtttaaaagtttgctccctatgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5686965 |
gctgctctatctagttataagtttaaaagtttgctccctttgct |
5687008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 39770094 - 39769980
Alignment:
| Q |
1 |
atgatagcagaccccaagttatgagagcacttggatatccattagaaacgacagacagaattccagaaattactgaagccaggaatatagagcttggact |
100 |
Q |
| |
|
||||||||||||||| |||||| | ||||| ||||||||||||| |||||| ||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
39770094 |
atgatagcagaccccgggttatgcaaatccttggttatccattagaaatgacagatagaattccagaaattactgaagctcggaatgtagagcttggact |
39769995 |
T |
 |
| Q |
101 |
tggattgcaggtagc |
115 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
39769994 |
tggtttgcaggtagc |
39769980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University